circad | circRNAs associated with diseases

hsa_circ_001242
Gene	TRDMT1	Organism	Human
Genome Locus	chr10:17157441-17168917:n/a	Build	hg19
Disease	Oral Squamous Cell Carcinoma	ICD-10	Carcinoma in situ of oral cavity, oesophagus and stomach (D00)
DBLink	Link to database	PMID	30069275
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Forty oral cancer tissue samples and paired adjacent normal tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCCCACTTGTAGAAGGTCCG Reverse CTGGCAGGGAGGGCTCATTA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Sun, S, Li, B, Wang, Y, Li, X, Wang, P, Wang, F, Zhang, W, Yang, H (2018). Clinical Significance of the Decreased Expression of hsa_circ_001242 in Oral Squamous Cell Carcinoma. Dis. Markers, 2018:6514795.